View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20902_low_28 (Length: 239)
Name: NF20902_low_28
Description: NF20902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20902_low_28 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 55192873 - 55193095
Alignment:
| Q |
18 |
atgtttttagttatactgaaaagtaactatactggaaaa-aacctacatattcagaagaccgttaatgcgtgattagttggataaaataaacctttttac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55192873 |
atgtttttagttatactgaaaagtaactatactggaaaaaaacctacatattcagaagaccgttaatgcgtgattagttggataaaataaacctttttac |
55192972 |
T |
 |
| Q |
117 |
agccatcaaataaaacaacccagagggcagatgcagagatgctagtcgttttattaggatgataaaatttagctaaaaggggcctaagtctaaggtgaaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55192973 |
agccatcaaataaaacaacccagagggcagatgcagagatgctagtcgttttattaggatgataaaatttagctaaaaggggcctaagtctaaggtgaaa |
55193072 |
T |
 |
| Q |
217 |
gatcagtttcgtgcttcaatttt |
239 |
Q |
| |
|
|||||||||||| |||||||||| |
|
|
| T |
55193073 |
gatcagtttcgtacttcaatttt |
55193095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University