View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20902_low_33 (Length: 236)
Name: NF20902_low_33
Description: NF20902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20902_low_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 11826662 - 11826883
Alignment:
| Q |
1 |
cttaatgcgtacacacgagtagctattctatatatttgagatctttatatgcgatacataaattgccaaaggatgattagttgcccttccatataggtta |
100 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11826662 |
cttaatgcatacacacgagtagctattctatatatttgagatctttatatgcgatacataaattgccaaaggataattagttgcccttccatataggtta |
11826761 |
T |
|
| Q |
101 |
agatcttgagggttttcagctatgacctaactagtagttaggtctaagatgaaccattttgcctttagtttcgcttctttacttccatcgtgttgatgca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11826762 |
agatcttgagggttttcagctatgacctaactagtagttaggtctaagatgaaccattttgcctttagtttcgcttctttacttccatcgtgttgatgca |
11826861 |
T |
|
| Q |
201 |
agcactttcgatgatgagatct |
222 |
Q |
| |
|
| |||||||||||||||||||| |
|
|
| T |
11826862 |
aacactttcgatgatgagatct |
11826883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 37 - 189
Target Start/End: Original strand, 11840528 - 11840686
Alignment:
| Q |
37 |
tgagatctttatatgcgatacataaattgccaaaggatgattagttgcccttccatataggttaagatcttgagggt---tttcagctatgacctaacta |
133 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||| ||||||||||| |||||||||||||||||||||| ||||| | |||||||| || |
|
|
| T |
11840528 |
tgagatctttatataggatacataaattgccaaaggatcattggttgcccttccttataggttaagatcttgagggtttctttcaaccatgacctagctt |
11840627 |
T |
|
| Q |
134 |
gtagttaggtctaa---gatgaaccattttgcctttagtttcgcttctttacttccatc |
189 |
Q |
| |
|
|||| ||||||||| || | || |||||||||| | ||| |||||||| |||||||| |
|
|
| T |
11840628 |
gtagctaggtctaacttgaagcactattttgccttcaattttgcttctttgcttccatc |
11840686 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University