View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20902_low_39 (Length: 208)
Name: NF20902_low_39
Description: NF20902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20902_low_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 195
Target Start/End: Original strand, 9016508 - 9016702
Alignment:
| Q |
1 |
ggacgagagttcaaactaagagcagtgacaagaggtggtggggtcgtagagatagggcaataaaatgaagcattattgttattttgatctgaagcaacag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9016508 |
ggacgagagttcaaactaagagcagtgacaagaggtggtggggtcgtagagatagggcaataaaatgaggcattattgttattttgatctgaagcaacag |
9016607 |
T |
 |
| Q |
101 |
aagaagatgaattattagaagaataatctaagctttttggtgggtctaaagtaaggggtcgagtgagaaagtcttgaaggataacaccaccacca |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9016608 |
aagaagatgaattattagaagaataatctaagctttttgttgggtctaaagtaaggggtcgagtgagaaagtcttgaaggataacaccaccacca |
9016702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 55; Significance: 8e-23; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 8e-23
Query Start/End: Original strand, 23 - 137
Target Start/End: Original strand, 5041928 - 5042042
Alignment:
| Q |
23 |
cagtgacaagaggtggtggggtcgtagagatagggcaataaaatgaagcattattgttattttgatctgaagcaacagaagaagatgaattattagaaga |
122 |
Q |
| |
|
|||||||||||||| || |||||| || |||||||| |||| |||||||||||||||||||||| |||||||| | |||||||||||||||||||| |
|
|
| T |
5041928 |
cagtgacaagaggtaatgtggtcgttgaagtagggcaaaaaaaggaagcattattgttattttgatatgaagcaatgaaggaagatgaattattagaaga |
5042027 |
T |
 |
| Q |
123 |
ataatctaagctttt |
137 |
Q |
| |
|
|||||| | |||||| |
|
|
| T |
5042028 |
ataatcgatgctttt |
5042042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University