View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20904_low_11 (Length: 265)
Name: NF20904_low_11
Description: NF20904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20904_low_11 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 10 - 251
Target Start/End: Complemental strand, 37625460 - 37625218
Alignment:
| Q |
10 |
aatattcgtggataactttgaacgaaacacacactctaaggtcagagtcatagttattt-tannnnnnnngaaagaagagtcattgttattataagtata |
108 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |||||||| ||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
37625460 |
aatattcgtggataactttgaaccaaacacacactctaaggttagagtcattgttatttatttattttttgaaagaagagtcattgttattataagtata |
37625361 |
T |
|
| Q |
109 |
ttttttaccaaatagaaattattatattttttgactaaaccaaatatagaaattataaatatttttggtggtgaagcctctctcattgcatgaggacaat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37625360 |
ttttttaccaaatagaaattattatattttttgactaaaccaaatatagaaattataaatatttttggtggtgaagcctctctcattgcatgaggacaat |
37625261 |
T |
|
| Q |
209 |
taattatattgtcgctgttggagaacttgccaatgagagaaat |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37625260 |
taattatattgtcgctgttggagaacttgccaatgagagaaat |
37625218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University