View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20904_low_13 (Length: 259)
Name: NF20904_low_13
Description: NF20904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20904_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 25 - 241
Target Start/End: Complemental strand, 32297699 - 32297505
Alignment:
| Q |
25 |
ggaaagaagtattaaacaatttttctaaaatataaatacaggaaataaacattattaaacagttcaaaatcgctagtatcatgtcataatatggaaattg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32297699 |
ggaaagaagtattaaacaatttttctaaaatataaatacaggaaataaacat------------------cgctagtatcatgtcataatatggaaattg |
32297618 |
T |
 |
| Q |
125 |
ttaagactacgtccttcgaagtagacctagattaatggctagagtgaggatggatattacacgattttgtgatcgatgtcatgtgttaatatttatacgt |
224 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32297617 |
ttaagactacgtccttggaagtagacctagattaatggctagagtga----ggatattacacgattttgtgatcgatgtcatgtgttaatatttatacgt |
32297522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University