View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20904_low_15 (Length: 237)

Name: NF20904_low_15
Description: NF20904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20904_low_15
NF20904_low_15
[»] chr7 (2 HSPs)
chr7 (18-122)||(42731858-42731963)
chr7 (195-237)||(42732043-42732085)


Alignment Details
Target: chr7 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 18 - 122
Target Start/End: Original strand, 42731858 - 42731963
Alignment:
18 ttagcaaaaatggaagtgtatggg-taccttggttatggttcacgatcgtgtctatccttagtttattagctggcagcattgaagtgtcgtttattatgt 116  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42731858 ttagcaaaaatggaagtgtatggggtaccttggttatggttcacgatcgtgtctatccttagtttattagctggcagcattgaagtgtcgtttattatgt 42731957  T
117 aggact 122  Q
    ||||||    
42731958 aggact 42731963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 195 - 237
Target Start/End: Original strand, 42732043 - 42732085
Alignment:
195 ggtttctcatgtaacaaaaaatatatatcttaaccctcatgtt 237  Q
    |||||||||||||||||||||||||||||||||||||||||||    
42732043 ggtttctcatgtaacaaaaaatatatatcttaaccctcatgtt 42732085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University