View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20904_low_15 (Length: 237)
Name: NF20904_low_15
Description: NF20904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20904_low_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 98; Significance: 2e-48; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 18 - 122
Target Start/End: Original strand, 42731858 - 42731963
Alignment:
| Q |
18 |
ttagcaaaaatggaagtgtatggg-taccttggttatggttcacgatcgtgtctatccttagtttattagctggcagcattgaagtgtcgtttattatgt |
116 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42731858 |
ttagcaaaaatggaagtgtatggggtaccttggttatggttcacgatcgtgtctatccttagtttattagctggcagcattgaagtgtcgtttattatgt |
42731957 |
T |
|
| Q |
117 |
aggact |
122 |
Q |
| |
|
|||||| |
|
|
| T |
42731958 |
aggact |
42731963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 195 - 237
Target Start/End: Original strand, 42732043 - 42732085
Alignment:
| Q |
195 |
ggtttctcatgtaacaaaaaatatatatcttaaccctcatgtt |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42732043 |
ggtttctcatgtaacaaaaaatatatatcttaaccctcatgtt |
42732085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University