View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20904_low_4 (Length: 480)
Name: NF20904_low_4
Description: NF20904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20904_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 384; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 384; E-Value: 0
Query Start/End: Original strand, 5 - 467
Target Start/End: Complemental strand, 35022130 - 35021668
Alignment:
| Q |
5 |
gagaggaattggagaagtggaccgatcaggttaacgccgggaatttcttgaaacgaggcggaggaaggtggaaaaggggaagttacggcggtggcgaggg |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| || |
|
|
| T |
35022130 |
gagaggaattggagaagtggaccgatcaggttaacgccgggaatttcttgaaacgcggcggaggaaggtggaaaaggggaagttacggcggtgacgaagg |
35022031 |
T |
 |
| Q |
105 |
ggaagggaattgaaatcggggatttt-cgaaatccgcgggcgcgcagggaggtgtgaacgttggagatggcgggaaggaggttgttgatggattcagggt |
203 |
Q |
| |
|
||||| | |||||| ||| |||||| |||| ||| || |||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35022030 |
agaaggaagttgaaa-cggagattttacgaataccgaggtcgcgaagggagatgtgaacgttggagatggcgggaaggaggttgttgatggattcagggt |
35021932 |
T |
 |
| Q |
204 |
aaacgtcggtgaaggcgttaccgacggagatggtggtgattttggcgcgtgggtagaagggaagcacgtgagtgtagatccatgcacgtgcgatggagcg |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35021931 |
aaacgtcggtgaaggcgttaccgacggagatggtggtgattttggcgcgtgggtagaagggaagcacgtgagtgtagatccatgcacgtgcgatggagcg |
35021832 |
T |
 |
| Q |
304 |
gttagtagcgatgtgagtgacgaggtagttggggattgtgaggaagagggagatgttggtgtagagaagagaacggattatggatgggtcgggttcttcg |
403 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35021831 |
gttagtggcgatgggagtgacgaggtagttggggattgtgaggaagagggagatgttggtgtagagaagagaacggattatggatgggtcgggttcttcg |
35021732 |
T |
 |
| Q |
404 |
agacggaggtgagtgagtttgagattttgcatggcggtggtgatgcggtcaggtgagggaggtg |
467 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
35021731 |
agacggaggtgagtgagtttgagattttgcatggcggtggtgatgcggtcaggtgagggtggtg |
35021668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 55; Significance: 2e-22; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 149 - 211
Target Start/End: Original strand, 42811513 - 42811575
Alignment:
| Q |
149 |
agggaggtgtgaacgttggagatggcgggaaggaggttgttgatggattcagggtaaacgtcg |
211 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42811513 |
agggagatgtgaacgttggagatggcggggaggaggttgttgatggattcagggtaaacgtcg |
42811575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University