View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20905_high_31 (Length: 306)
Name: NF20905_high_31
Description: NF20905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20905_high_31 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 124; Significance: 8e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 33 - 168
Target Start/End: Original strand, 27976037 - 27976172
Alignment:
| Q |
33 |
actacatgaatgcgtgtatttatgtttgcatgaaatccaaatcccattattttcgtatatctgacatggaaattggtagaattgctacgtgtgacaactg |
132 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
27976037 |
actacatgaatgcgtgtatttatgtttgcatgaaatccaaatcccattattttagtatatctgacatggaaattggtagaattgctatgtgtgacaactg |
27976136 |
T |
|
| Q |
133 |
acaacttgtttgaatatctgcacatatgataataag |
168 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
27976137 |
acaacttgtttgaatatctgcacataggataataag |
27976172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 208 - 291
Target Start/End: Original strand, 27976206 - 27976289
Alignment:
| Q |
208 |
attcctgtaataatctgtaagattttattattagcagaatggaactcaagtttctaagtatagcacctcaaaatagttcaaaat |
291 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27976206 |
attcctgtaataatttgtaagattttattattagcagaatggaactcaagtttctaagtatagcacctcaaaatagttcaaaat |
27976289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University