View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20905_high_39 (Length: 255)
Name: NF20905_high_39
Description: NF20905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20905_high_39 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 16 - 246
Target Start/End: Complemental strand, 11727885 - 11727655
Alignment:
| Q |
16 |
agaaattctaagcaaactaacccggcaaacgatcattttagcccacttcttcgtacgctgatcaagaaataggttcatcttaatctcatataaataagat |
115 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
11727885 |
agaaattctaagcaaactgacccggcaaacgatcattttagcccacttcttcgtacgctgatcaagaaataggttcatcttaatctgatataaataagac |
11727786 |
T |
 |
| Q |
116 |
aagagcataaacaaagtgtgtctttgaaagtataaaaaatataaagttaaaggcttcgtcgaggaattttcacgaatatggtgatggttagaagtgtcac |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
11727785 |
aagagcataaaaaaagtgtgtctttgaaagtataaaaaatataaagttaacggcttcatcgaggaattttcacgattatggtgatggttagaagtgtcac |
11727686 |
T |
 |
| Q |
216 |
taaaagtgtgtggaattgcttaaaactttgg |
246 |
Q |
| |
|
||| ||||||| ||||||||||| ||||||| |
|
|
| T |
11727685 |
taatagtgtgtcgaattgcttaagactttgg |
11727655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University