View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20905_high_47 (Length: 239)
Name: NF20905_high_47
Description: NF20905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20905_high_47 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 18 - 218
Target Start/End: Complemental strand, 42760124 - 42759924
Alignment:
| Q |
18 |
attctgacagttattacctttagagcataaacagattgaatacaagcatatgtctatcgatatggtgtttgcctcatctagtaccagtaaataaagttcc |
117 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42760124 |
attctgacagttattaccgttagagcataaacaaattgaatacaagcatatgtctatcgatatggtgtttgcctcatctagtaccagtaaataaagttcc |
42760025 |
T |
|
| Q |
118 |
atacaatttgaagtttggttggtagttaatatctggtcaataaccgtttcagtgatcaaactcgaatgctctcaattggatagaatttatcttttaaaaa |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42760024 |
atacaatttgaagtttggttggtagttaatatctggtcaataaccgtttaactgatcaaactcgaatgctctcaattggatagaatttatcttttaaaaa |
42759925 |
T |
|
| Q |
218 |
t |
218 |
Q |
| |
|
| |
|
|
| T |
42759924 |
t |
42759924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 122 - 195
Target Start/End: Complemental strand, 42750581 - 42750508
Alignment:
| Q |
122 |
aatttgaagtttggttggtagttaatatctggtcaataaccgtttcagtgatcaaactcgaatgctctcaattg |
195 |
Q |
| |
|
||||| |||||| ||||||||||| ||||| ||||||| |||||| |||| ||||||||||||||||||||| |
|
|
| T |
42750581 |
aatttaaagttttgttggtagttagtatctagtcaatagttgtttcactgatgaaactcgaatgctctcaattg |
42750508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 18 - 77
Target Start/End: Original strand, 23043188 - 23043247
Alignment:
| Q |
18 |
attctgacagttattacctttagagcataaacagattgaatacaagcatatgtctatcga |
77 |
Q |
| |
|
|||||||||||||||||| |||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
23043188 |
attctgacagttattaccgttagagcatagatgaattgaatacaagcatatgtctatcga |
23043247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University