View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20905_low_2 (Length: 781)
Name: NF20905_low_2
Description: NF20905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20905_low_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 505 - 762
Target Start/End: Original strand, 3144802 - 3145059
Alignment:
| Q |
505 |
ctgaatataaaccgaaatagttttggtgtttgatgagtcactgctagtaaccgcttgattcttctatgcatgtttggtatcacttgaatcacggtgaaca |
604 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3144802 |
ctgaatataaaccgaaatagttttggtgtttgatgagtcactgctagtaaccgcttgattcttctatgcatgtttggtatcacttaaatcacggtgaaca |
3144901 |
T |
 |
| Q |
605 |
accgtgattttgcagaagctacggggtggttcgccttgattctaacaaactgataatgataccaaaacatatacaaaacaatgttttaaaaaccaaacat |
704 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3144902 |
accgtgattttgcagaagctacggggtggttcaccttgattctaacaaactgataatgatacaaaaacatatacaaaacaatgttttaaaaaccaaacat |
3145001 |
T |
 |
| Q |
705 |
ggtaccatgttaggttgctggtatcacggtgactagccgtgcttttgcaaaagctata |
762 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3145002 |
ggtaccatgttaggttgctggtatcacggtgactagctgtgcttttgcaaaagctata |
3145059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 141; E-Value: 2e-73
Query Start/End: Original strand, 19 - 167
Target Start/End: Original strand, 3144353 - 3144501
Alignment:
| Q |
19 |
caaccataatcttaactcatcttggacttggttttaagcaaataaggcggcgaccattactctctcttcttcactttctctattatttctgacttcattc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3144353 |
caaccataatcttaactcatcttggacttagttttaagcaaataaggcggcgaccattactctctcttcttcactttctctattatttctgacttcattc |
3144452 |
T |
 |
| Q |
119 |
accaactaacattattaactgcattcatttccttcattaccttaacacg |
167 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3144453 |
accaacttacattattaactgcattcatttccttcattaccttaacacg |
3144501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 65; E-Value: 4e-28
Query Start/End: Original strand, 298 - 362
Target Start/End: Original strand, 3144630 - 3144694
Alignment:
| Q |
298 |
tgaagtttatgaagttgggttcaaagcctgatgcacttcaatctgatggcaagtttgtcaggtta |
362 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3144630 |
tgaagtttatgaagttgggttcaaagcctgatgcacttcaatctgatggcaagtttgtcaggtta |
3144694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.000000001
Query Start/End: Original strand, 242 - 279
Target Start/End: Original strand, 3144575 - 3144612
Alignment:
| Q |
242 |
aacatacgtgaccctactttctttgtttggttttcaag |
279 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3144575 |
aacatacgtgatcctactttctttgtttggttttcaag |
3144612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University