View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20905_low_22 (Length: 375)
Name: NF20905_low_22
Description: NF20905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20905_low_22 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 103; Significance: 4e-51; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 40 - 174
Target Start/End: Complemental strand, 8296638 - 8296504
Alignment:
| Q |
40 |
atttctgtaaatttattgtcttccatgaggccccttcatattttataagagcttctaatatagtttgtgctcctttttcattttccctaaaaattaggaa |
139 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| | ||| |||||| |
|
|
| T |
8296638 |
atttatgtaaatttattgtcttccctgaggccccttcatattttataagagcttctaatatagtttgtgcttctttttcattttccccacaaaataggaa |
8296539 |
T |
 |
| Q |
140 |
acagttgtcagcacattataagtgtgtcaggagtg |
174 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
8296538 |
acagttgtcagcatattataagtgtgtaaggagtg |
8296504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 58; Significance: 3e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 272 - 369
Target Start/End: Original strand, 15163048 - 15163144
Alignment:
| Q |
272 |
gtcgtaagcctttaccaggatccctgtaaaccaataccatcaccatttacaagcacttgatatttcacattagccatacaaattcccattcatctcac |
369 |
Q |
| |
|
||||||||||| | |||||||| | |||||||||||||||||||||||||| |||||||||||| |||||| |||||||||||||||||||| |||| |
|
|
| T |
15163048 |
gtcgtaagcctcttccaggatct-tataaaccaataccatcaccatttacaaacacttgatattttacattatccatacaaattcccattcatgtcac |
15163144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 4e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 296 - 369
Target Start/End: Complemental strand, 14343568 - 14343495
Alignment:
| Q |
296 |
tgtaaaccaataccatcaccatttacaagcacttgatatttcacattagccatacaaattcccattcatctcac |
369 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||| |||| ||| |||| |
|
|
| T |
14343568 |
tgtaaaccaataccatcattgtttacaagcacttgatacttcacattagccatacaaatttccatccatttcac |
14343495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University