View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20905_low_30 (Length: 322)
Name: NF20905_low_30
Description: NF20905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20905_low_30 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 68 - 312
Target Start/End: Complemental strand, 1966422 - 1966178
Alignment:
| Q |
68 |
tatttgacaagaaaacgaactagagttacccaatgagaaatgaatattaatttcatgtcatgtcatagtccctcgatggcaattaactcctagcgatgaa |
167 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1966422 |
tatttgacaagaaaacaaactagagttacccaatgagaaatgaatattaatttcatgtcatgtcatagtccctcgatggcaattaactcctagctatgaa |
1966323 |
T |
|
| Q |
168 |
tttgaatttgtatatcccatgaatatcaacctttcacttgggataaaacttgggtacaatgttatagataacatttgaggcgtgtcagacactaaatatg |
267 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||| ||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
1966322 |
tttgaatttgtatatcccatgaatatcaaggtttcacttgggacaaaacttgggtacaatattatagataacatttgaggtgtgtcagacattaaatatg |
1966223 |
T |
|
| Q |
268 |
cgtacctatttaagttggaattcaaattttggttcaccatattat |
312 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1966222 |
cgtacctcttttagttggaattcaaattttggttcaccatattat |
1966178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 18 - 72
Target Start/End: Complemental strand, 1966513 - 1966459
Alignment:
| Q |
18 |
aagtcaatcataactaccatgatattaatcattgacattccatggctttttattt |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1966513 |
aagtcaatcataactaccatgatattaatcattgacattccatggcttttaattt |
1966459 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University