View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20905_low_35 (Length: 286)

Name: NF20905_low_35
Description: NF20905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20905_low_35
NF20905_low_35
[»] chr1 (1 HSPs)
chr1 (24-242)||(41989690-41989913)


Alignment Details
Target: chr1 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 24 - 242
Target Start/End: Complemental strand, 41989913 - 41989690
Alignment:
24 cgacgagatcttcaaatcataattcaaccaagcgggttcaa--------gaaccaaatgactaataaaaaatatatataaaagcaacctcaattcaatta 115  Q
    ||||||||||||||||||||||||||||||| |||||||||        ||||||||||| |||||||||   |||||| ||||||||||||||||||||    
41989913 cgacgagatcttcaaatcataattcaaccaaacgggttcaactgcgattgaaccaaatgattaataaaaa---tatatataagcaacctcaattcaatta 41989817  T
116 gattaagcttcaaacaagattgaatcaaccgataaactgaccggtttctagttcaaatggttaacccggttgattcggtcataatttaagaacattggtt 215  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41989816 gattaagcttcaaacaagatcgaatcaaccgataaactgaccggtttctagttcaaatggttaacccggttgattcggtcataatttaagaacattggtt 41989717  T
216 attactactagtggcatttgagccaca 242  Q
    ||||||||||||||| |||||||||||    
41989716 attactactagtggcctttgagccaca 41989690  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University