View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20905_low_35 (Length: 286)
Name: NF20905_low_35
Description: NF20905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20905_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 24 - 242
Target Start/End: Complemental strand, 41989913 - 41989690
Alignment:
| Q |
24 |
cgacgagatcttcaaatcataattcaaccaagcgggttcaa--------gaaccaaatgactaataaaaaatatatataaaagcaacctcaattcaatta |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| ||||||||||| ||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
41989913 |
cgacgagatcttcaaatcataattcaaccaaacgggttcaactgcgattgaaccaaatgattaataaaaa---tatatataagcaacctcaattcaatta |
41989817 |
T |
 |
| Q |
116 |
gattaagcttcaaacaagattgaatcaaccgataaactgaccggtttctagttcaaatggttaacccggttgattcggtcataatttaagaacattggtt |
215 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41989816 |
gattaagcttcaaacaagatcgaatcaaccgataaactgaccggtttctagttcaaatggttaacccggttgattcggtcataatttaagaacattggtt |
41989717 |
T |
 |
| Q |
216 |
attactactagtggcatttgagccaca |
242 |
Q |
| |
|
||||||||||||||| ||||||||||| |
|
|
| T |
41989716 |
attactactagtggcctttgagccaca |
41989690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University