View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20905_low_44 (Length: 250)

Name: NF20905_low_44
Description: NF20905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20905_low_44
NF20905_low_44
[»] chr5 (1 HSPs)
chr5 (1-237)||(40054500-40054736)


Alignment Details
Target: chr5 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 40054736 - 40054500
Alignment:
1 ttaaggaaaagggctttattgatgaaaagggatatatgaggaaagacggtcggaaaatgaaatggcaaaatattcttgacgagaggaaaaatctcttgat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40054736 ttaaggaaaagggctttattgatgaaaagggatatatgaggaaagacggtcggaaaatgaaatggcaaaatattcttgacgagaggaaaaatctcttgat 40054637  T
101 tgataaacatttgatccctcatatccaggaggagctaaaccttgcatttgcttaccatgagatgacgagtgtgcattgcgaccaaatttttaaatggttt 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||    
40054636 tgataaacatttgatccctcatatccaggaggagctaaaccttgcattttcttaccatgagatgacgagtgtgcattccgaccaaatttttaaatggttt 40054537  T
201 gaatctcatatgggctgattagaacttacaatgctct 237  Q
    ||||||||||| |||||||||||||||||||||||||    
40054536 gaatctcatattggctgattagaacttacaatgctct 40054500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University