View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20905_low_57 (Length: 218)
Name: NF20905_low_57
Description: NF20905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20905_low_57 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 20 - 208
Target Start/End: Complemental strand, 45145224 - 45145034
Alignment:
| Q |
20 |
aaccgttattaccagaaaccccaaaagaaaaaaggtgagtataagctctgtatatgtatgtatccctcggatcttctaatgattgaagcatttcataaat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45145224 |
aaccgttattaccagaaaccccaaaagaaaaaaggtgagtataagctctgtatatgtatgtatccctcggatcttctaatgattgaagcatttcataaat |
45145125 |
T |
 |
| Q |
120 |
ctaaaaattaaagaacac----ttagttatgtctacaagtgtgttttctttcctctgattttagttacatatgtttaacatatcttgatgatg |
208 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||| |||||||||| ||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
45145124 |
ctaaaatttaaagaacacttaattagttatgtctacaagagtgttttcttccctctgactttagttac--atgtttaacatatcttgatgatg |
45145034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University