View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20905_low_58 (Length: 210)
Name: NF20905_low_58
Description: NF20905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20905_low_58 |
 | |
|
| [»] scaffold0128 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0128 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: scaffold0128
Description:
Target: scaffold0128; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 34 - 194
Target Start/End: Original strand, 18223 - 18391
Alignment:
| Q |
34 |
catatgggtcgtcactgcaatttggactcgtattcatgttt-tagattcaatagat----catgtgtcgtcactccaacctatcataatcatttcgtttg |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| | |||||||||||| ||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
18223 |
catatgggtcgtcactgcaatttggactcgtggtcatgtttgtcgattcaatagattgatcatgtgtcgtcactccaacctgtcataatcatgtcgtttg |
18322 |
T |
|
| Q |
129 |
ctattcagacactc---atgtaatacaattggtttgtgatcctttgaatgtgtttgtcaacatgatcag |
194 |
Q |
| |
|
||||||| |||||| ||||||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
18323 |
ctattcatacactcttcatgtaattcaattggtttgtgatcctttgaatgtgtttgtcaacttgatcag |
18391 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University