View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20906_low_3 (Length: 282)
Name: NF20906_low_3
Description: NF20906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20906_low_3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 11 - 266
Target Start/End: Complemental strand, 41105785 - 41105530
Alignment:
| Q |
11 |
aatgatttgtcgcatnnnnnnncacggtatgaatatgacatgtactatagatagtctaaggttattagaaaatgaaattagaaacttcgtgtgtttttcc |
110 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41105785 |
aatgatttgtcgcataaaaaaacacggtatgaatatgacatgtactatagatagtcttaggttattagaaaatgaaattagaaacttcgtgtgtttttcc |
41105686 |
T |
|
| Q |
111 |
tttcaccaaaaataaagctactttataaaatcccactcactctacaatattcaacactttgtaaattaactgaaacttccaaatcatagattgtacgtat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41105685 |
tttcaccaaaaataaagctactttataaaatcccactcactctacaatattcaacactttgtaaattaactgaaacttccaaatcatagattgtacgtat |
41105586 |
T |
|
| Q |
211 |
ttatttacttcaactcacacactcttgtcattgtcttagagaaatttattgatatg |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41105585 |
ttatttacttcaactcacacactcttgtcattgtcttagataaatttattgatatg |
41105530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University