View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20906_low_6 (Length: 225)
Name: NF20906_low_6
Description: NF20906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20906_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 20 - 211
Target Start/End: Complemental strand, 5370041 - 5369849
Alignment:
| Q |
20 |
agtctacttaatagttaatacacaatctaaatttcgtatatggtagctaacaagtcacaatctcacaccagnnnnnnn-ggacaaaaacaatttggaacc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5370041 |
agtctacttaatagttaatacacaatctaaatttcgtatatggtagctaacaagtcacaatctcacaccagaaaaaaaaggacaaaaacaatttggaacc |
5369942 |
T |
 |
| Q |
119 |
atttgtataaagtcatctatggttgaatgatgacgttcattcttcttaatagaattgacatccaacaaaagctttaactgcatggagtataat |
211 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5369941 |
atttgtataaagtcatctatggttgattgatgacgttcattcttcttaatagaattgacatccaacaaaagctttaactgcatggattataat |
5369849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University