View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20907_low_12 (Length: 261)
Name: NF20907_low_12
Description: NF20907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20907_low_12 |
 |  |
|
| [»] chr6 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 215 - 261
Target Start/End: Complemental strand, 31968259 - 31968213
Alignment:
| Q |
215 |
atcccttgcgttgcagcataccttgaatctcctttgcaatattattt |
261 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31968259 |
atcccttgcattgcagcataccttgaatctcctttgcaatattattt |
31968213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 77 - 200
Target Start/End: Complemental strand, 31958956 - 31958840
Alignment:
| Q |
77 |
gcatcatgtcattaggatattttagttttgcagttgcaaaagcatgctcggattcgaattaactaactaaagagtttaacttacacggccagaagactag |
176 |
Q |
| |
|
||||||| ||||| |||||| || | ||||||||| |||||| |||||||||| |||| |||| || ||||||||||||||||||||||||| | |
|
|
| T |
31958956 |
gcatcatatcattgggatatgtttggtttgcagtttcaaaagtatgctcggatccgaa-------actatagtgtttaacttacacggccagaagactgg |
31958864 |
T |
 |
| Q |
177 |
ttggaccctccaaaattgttgtta |
200 |
Q |
| |
|
||| |||||||||| || ||||| |
|
|
| T |
31958863 |
ctgggccctccaaaactgctgtta |
31958840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 148 - 200
Target Start/End: Complemental strand, 31966200 - 31966148
Alignment:
| Q |
148 |
gagtttaacttacacggccagaagactagttggaccctccaaaattgttgtta |
200 |
Q |
| |
|
|||||||| |||||||| ||||||||||| |||||||||||||| |||||||| |
|
|
| T |
31966200 |
gagtttaatttacacggtcagaagactagctggaccctccaaaactgttgtta |
31966148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University