View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20907_low_3 (Length: 522)
Name: NF20907_low_3
Description: NF20907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20907_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 9e-96; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 9e-96
Query Start/End: Original strand, 325 - 506
Target Start/End: Complemental strand, 50605307 - 50605126
Alignment:
| Q |
325 |
tggtggatgaatcaaatgcttatcatccttaacttgtctaccatccgccacttcaaacaagccagtgacaagtagaatattgcacaggatgaaagcaacc |
424 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50605307 |
tggtggatgaatcaaatgcttatcatccttaacttgtctaccatccgccacttcaaacaagccagtgacaagtagaatattgcacaggatgaaagcaacc |
50605208 |
T |
 |
| Q |
425 |
acaacgccattagaaaaaactctcattgttagcgaacttaatgaatgtgtagtattgaaggaaggagtagtgaggttatatt |
506 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50605207 |
acaacgccattagaaaaaactctcattgttagtgaacttaatgaatgtgtagtattgaaggaaggagtagtgaggttatatt |
50605126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 299 - 336
Target Start/End: Complemental strand, 50605348 - 50605311
Alignment:
| Q |
299 |
tgtttgaatccgtgacctaacaaatgtggtggatgaat |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50605348 |
tgtttgaatccgtgacctaacaaatgtggtggatgaat |
50605311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University