View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20908_high_9 (Length: 352)
Name: NF20908_high_9
Description: NF20908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20908_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 8 - 334
Target Start/End: Complemental strand, 35446512 - 35446186
Alignment:
| Q |
8 |
gagcacagaaatacatgacctgcagaattgcatcagggtttttcatgacaatttgctttccttcatttccacttgtagtgcagaaaatgtaagttccaaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35446512 |
gagcacagaaatacatgacctgcagaatagcatcagggtttttcatgacaatttgctttccttcatttccacttgtagtgcagaaaatgtaagttccaaa |
35446413 |
T |
|
| Q |
108 |
gggtctataaggactcaaaggaacaaaatttgcaatagtttcaagtgttgcttctgttgttcccattagcctacaagcagcatgtcgtgtgacagttgta |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35446412 |
gggtctataaggactcaaaggaacaaaatttgcaatagtttcaagtgttgcttctgttgttcccattagcctacaagcagcatgtcgtgtgacagttgta |
35446313 |
T |
|
| Q |
208 |
gcatttgacattactccaaagtagaaatccgaagttgaagcgattcttccaagactcgattcattcatgaatgatttgcttttgggatctaagagctgtg |
307 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35446312 |
gcatttgacattacttcaaagtagaaatccgaagttgaagcgattcttccaagactcgattcattcatgaatgatttgcttttgggatctaagagctgtg |
35446213 |
T |
|
| Q |
308 |
caactgtttcaaatttttggtcgaaag |
334 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
35446212 |
caactgtttcaaatttttggtcgaaag |
35446186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University