View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20908_low_15 (Length: 251)
Name: NF20908_low_15
Description: NF20908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20908_low_15 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 18 - 251
Target Start/End: Original strand, 43309529 - 43309767
Alignment:
| Q |
18 |
gaaatctagtcgccaactcaatttgggtatgtttagattaatttatttgactttattttatcttatcttatcttttgtcatagaaataa-atagcttata |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
43309529 |
gaaatctagtcgccaactcaatttgggtatgtttagattaatttatttgactttattttatcttatctt-----ttgtcatagaaatagcatagcttata |
43309623 |
T |
 |
| Q |
117 |
tacgagagtacatatgtgat-----------tgcattaattcaattttggtgttttaggtagagatggtttcatacataacatgttggataatatacatg |
205 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43309624 |
tacgag--tacatatgtgatagcacttatgatgcattaattcaattttggtgttttaggtagagatggtttcatacataacatgttggataatatacatg |
43309721 |
T |
 |
| Q |
206 |
ctcattggaagcgtcgaagggtgtgtaagatcaagtgcataggagt |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43309722 |
ctcattggaagcgtcgaagggtgtgtaagatcaagtgcataggagt |
43309767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University