View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20908_low_19 (Length: 238)
Name: NF20908_low_19
Description: NF20908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20908_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 17 - 230
Target Start/End: Original strand, 36876312 - 36876524
Alignment:
| Q |
17 |
tgattatcccatttattatcaactttctctttgccaattcctcttagtcaactcctaaattgtctccttcaaggattttgttgagtccctaacatgcaat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
36876312 |
tgattatcccatttattatcaactttctctttgccaattcctcttagtcaactcccaaattgtctacttcaaggattttgttgagtcccagacatgcaat |
36876411 |
T |
 |
| Q |
117 |
atacttgattaagttgtttttccaagttacgtagttgcccccagtcatgtttaaaattttgaatggtgcttaacattcaacataattatatatagaatac |
216 |
Q |
| |
|
|||||| |||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
36876412 |
atacttaattaagttgtttttccaagttatgtagttg-ccccagtcatgtttaaaattttgaatggtgcttaacattcaacataattatatctagaatac |
36876510 |
T |
 |
| Q |
217 |
ataagagaataatc |
230 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
36876511 |
ataagagaataatc |
36876524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 74 - 180
Target Start/End: Original strand, 25329069 - 25329175
Alignment:
| Q |
74 |
aattgtctccttcaaggattttgttgagtccctaacatgcaatatacttgattaagttgtttttccaagttacgtagttgcccccagtcatgtttaaaat |
173 |
Q |
| |
|
||||||||||||| | ||||||| ||||| || |||||||| ||||| ||| |||||||| |||||||||| |||||| || |||| |||||| ||| |
|
|
| T |
25329069 |
aattgtctccttcgaaaattttgtcgagtctctcacatgcaagatactcgatcaagttgttgttccaagttatatagttgtcctcagttatgtttgcaat |
25329168 |
T |
 |
| Q |
174 |
tttgaat |
180 |
Q |
| |
|
||||||| |
|
|
| T |
25329169 |
tttgaat |
25329175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University