View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20908_low_22 (Length: 234)
Name: NF20908_low_22
Description: NF20908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20908_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 82; Significance: 7e-39; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 1 - 119
Target Start/End: Complemental strand, 13709416 - 13709299
Alignment:
| Q |
1 |
gatattaattaattttagtatttttatgaactaatataaaaaatatgattggatggtaactannnnnnncgatattgtcggcgtatataaaattaaacgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||| | |
|
|
| T |
13709416 |
gatattaattaattttagtatttttatgaactaatataaaaaatatgattggatggtaactatttttttcgatattgtcggcgta-ataaaattaaaatt |
13709318 |
T |
 |
| Q |
101 |
acatatgtgtaattccctt |
119 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
13709317 |
acatatgtgtaattccctt |
13709299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University