View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20909_high_11 (Length: 403)
Name: NF20909_high_11
Description: NF20909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20909_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 4e-54; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 4e-54
Query Start/End: Original strand, 281 - 392
Target Start/End: Original strand, 8924277 - 8924388
Alignment:
| Q |
281 |
ggtggtagccacctgtgactgtggagttgggtgattttgtgaagaagaaaacgaacaagcattccccaccaaaaacaaagatgactcaaactccttaatg |
380 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8924277 |
ggtggtagccacctgtgactgtggagttgggtgattttgtgaagaagaaatcgaacaagcattccccaccaaaaacaaagatgactcaaactccttaatg |
8924376 |
T |
|
| Q |
381 |
aataatatgatg |
392 |
Q |
| |
|
|||||||||||| |
|
|
| T |
8924377 |
aataatatgatg |
8924388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 8923972 - 8924075
Alignment:
| Q |
1 |
tcaaagacaaagattatgacattatatttttt-acttcattatcctattataannnnnnnatgaccgaaagttttaagtgagttgcaaggccgcaaatag |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8923972 |
tcaaagacaaagattatgacattatatttttttatttcattatcctattataatttttttatgaccgaaagttttaagtgagttgcaaggccgcaaatag |
8924071 |
T |
|
| Q |
100 |
taag |
103 |
Q |
| |
|
|||| |
|
|
| T |
8924072 |
taag |
8924075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University