View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20909_high_17 (Length: 325)
Name: NF20909_high_17
Description: NF20909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20909_high_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 3e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 75 - 177
Target Start/End: Complemental strand, 24619929 - 24619827
Alignment:
| Q |
75 |
aaagtagaaaatatttgactcaaaatcgcatgagttatgatatagggaaaatatataatgatcatgatgaatgtctcttgcgcagcatgccctcaatcat |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24619929 |
aaagtagaaaatatttgactcaaaatcgcatgagttatgatatagggaaaatatataatgatcatgatgaatgtctcttgcgcagcatgccctcaatcat |
24619830 |
T |
|
| Q |
175 |
aat |
177 |
Q |
| |
|
||| |
|
|
| T |
24619829 |
aat |
24619827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 9 - 47
Target Start/End: Complemental strand, 24619962 - 24619924
Alignment:
| Q |
9 |
acaaaatctcattggttatgatatgtgctaattaaagta |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24619962 |
acaaaatctcattggttatgatatgtgctaattaaagta |
24619924 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 78; Significance: 3e-36; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 78; E-Value: 3e-36
Query Start/End: Original strand, 237 - 314
Target Start/End: Complemental strand, 31375526 - 31375449
Alignment:
| Q |
237 |
aaactgaatgattctcttgagcatgacagacatataagcattaaaaagaattgtcatctgtacctctatggagttctt |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31375526 |
aaactgaatgattctcttgagcatgacagacatataagcattaaaaagaattgtcatctgtacctctatggagttctt |
31375449 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University