View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20909_high_18 (Length: 317)
Name: NF20909_high_18
Description: NF20909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20909_high_18 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 42 - 317
Target Start/End: Complemental strand, 36465017 - 36464737
Alignment:
| Q |
42 |
atgtgggaaaatgaacaaaatcaaccaagcatgggagacataaattcactttgacttgtcattatggtacatttttgtagccgagaagcggaaaatataa |
141 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36465017 |
atgtgggaaaatgaacaaaatcaaccaggcgtgggagacataaattcactttgacttgtcattatggtacatttttgtagccgagaagcggaaaatataa |
36464918 |
T |
 |
| Q |
142 |
agtattctgcggttaagcttcgattgctcaattaaggaaggatatgccactactatgatgagagtagagacattcttggttaagagagtgagagttggag |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36464917 |
agtattctgcggttaagcttcgattgctcaatta----aggatatgccactactatgatgagagtagagacattcttggttaagagagtgagagttggag |
36464822 |
T |
 |
| Q |
242 |
gagttagtgagagaatgtaaaagagcaacttgaggaataat---------atttttctatatatccttctacttctaattcataa |
317 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
36464821 |
gagttagtgagagaatgtgaaagagcaacttgaggaataatatctcaaccatttttctatatatccttctacttctaattcataa |
36464737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University