View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20909_high_27 (Length: 242)
Name: NF20909_high_27
Description: NF20909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20909_high_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 16 - 223
Target Start/End: Original strand, 28440916 - 28441123
Alignment:
| Q |
16 |
atgaaaaatatgacacaaggatgcgtgattaccgtgatagaatactcactttttgttgaaatatacatatgaagtgtcgtttcataacatacaaagtgca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28440916 |
atgaaaaatatgacacaaggatgcgtgattaccgtgatagaatactcactttttgttgaaatatacatatgaagtgtcgtttcataacatacaaagtgca |
28441015 |
T |
|
| Q |
116 |
agaagctcatgacatatgcattaactctattctcccatgattcttaccacaaaacttctgtccccatcttccttttatcactttgatgatgaatagatac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28441016 |
agaagctcatgacatatgcattaactctattctcccatgattcttaccccaaaacttctgtccccatcttccttttatcactttgatgatgaatagatac |
28441115 |
T |
|
| Q |
216 |
ccaccact |
223 |
Q |
| |
|
|||||||| |
|
|
| T |
28441116 |
ccaccact |
28441123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University