View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20909_high_7 (Length: 449)
Name: NF20909_high_7
Description: NF20909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20909_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 4e-85; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 4e-85
Query Start/End: Original strand, 97 - 268
Target Start/End: Original strand, 9950129 - 9950300
Alignment:
| Q |
97 |
caagggtaatcactaatccattttgctacaaatatttgtcccataacattcattattttcacctgtaaaacatagtaatacacaatacctagctagtatc |
196 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9950129 |
caagggtaatcacttagccattttgctacaaatatttgtcccataacattcattattttcacctgtaaaacatagtactacacaatacctagctagtatc |
9950228 |
T |
 |
| Q |
197 |
aaactcaaaacaatgcatattcaatttcaaacttgtcactcaattaagacacttccattaacatggaacatt |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9950229 |
aaactcaaaacaatgcatattcaatttcaaacttgtcactcaattaagacacttccattaacatggaacatt |
9950300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 385 - 432
Target Start/End: Original strand, 9950417 - 9950464
Alignment:
| Q |
385 |
gctagaaattttcaaatcactagaaaactgggcttctgagtctgtttt |
432 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9950417 |
gctagaaattttcaaatcactagaaaactgggcttctgagtctgtttt |
9950464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University