View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20909_low_1 (Length: 679)
Name: NF20909_low_1
Description: NF20909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20909_low_1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 233; Significance: 1e-128; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 233; E-Value: 1e-128
Query Start/End: Original strand, 16 - 272
Target Start/End: Complemental strand, 30338746 - 30338490
Alignment:
| Q |
16 |
attaacgaagcttactttggcgcggcgaccgagatccacagatccaccggattcttgcctgtcgtcgtgagccagagaatcctatgaatataaacaaaca |
115 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30338746 |
attaatgaagcttactttggcgcggcgaccgagatccacagatccaccggattcttgcctgtcgtcgtgagccagagaatcctatgaatataaacaaaca |
30338647 |
T |
|
| Q |
116 |
cattacggcggcgattgatgcatgaaaacgcgtagaatgggtgagaaatgaagctgacctgagcgaaggtttgaacaacgaagcagaggagaagagcgag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30338646 |
cattacggcggcgattgatgcatgaaaacgcgtagaatggaagggaaatgaagctgacctgagcgaaggtttgaacgacgaagcagaggagaagagcgag |
30338547 |
T |
|
| Q |
216 |
aacggtgattcctccattggtgttgaatcgtagtgccatggtgaatctgtggcggtt |
272 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30338546 |
aaaggtgattcctccattggtgttgaatcgtagtgccatggtgaatctgtggcggtt |
30338490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 166; E-Value: 2e-88
Query Start/End: Original strand, 402 - 645
Target Start/End: Complemental strand, 30338351 - 30338099
Alignment:
| Q |
402 |
gaagaaaattagaaagtgagatagatccggtagtggg-atctggttatggttttgatacggatctgagttattttatgattgcttgaattgaaatgaagg |
500 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30338351 |
gaagaaaattagaaagtgagatagatccggtagtggggatctggttatggttttgatacggatctgagttattttatgattgcttgaattgaaatgaagc |
30338252 |
T |
|
| Q |
501 |
tgatggagagagaaccttcgatgcaagatccccaaacacggtttttgctactttacgcattttgtattatcattc--------gnnnnnnnnnnnnnnaa |
592 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
30338251 |
tgatggagagagaaccttcgatgcaagatccccaaacacggtttttgctactttacgcattttgtattatcattcgtttttttgttttttttttttttaa |
30338152 |
T |
|
| Q |
593 |
ttctggctttgtgagtttttgcgactttcgaaacataaggttagcaattttaa |
645 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30338151 |
ttctggctttgtgagtttttgctactttcgaaacataaggttagcaattttaa |
30338099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University