View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20909_low_18 (Length: 357)
Name: NF20909_low_18
Description: NF20909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20909_low_18 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 314; Significance: 1e-177; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 314; E-Value: 1e-177
Query Start/End: Original strand, 14 - 339
Target Start/End: Original strand, 35178173 - 35178498
Alignment:
| Q |
14 |
atatgtatgctgaattgggtcggattgattttgtacggaaactgtttgatgaaatttctgagagagatagtgtttcgtggaatgttatgatttctggttg |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35178173 |
atatgtatgctgaattgggtcggattgattttgtacggaaactgtttgatgaaatttctgagagagatagtgtttcgtggaatgttatgatttctggttg |
35178272 |
T |
|
| Q |
114 |
tgtaaagtgtagtagatttgaagaggcggtggaggttttccaaaggatgagggtggatagtaatgagaagattagtgaagctactgttgttagtagtttg |
213 |
Q |
| |
|
||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35178273 |
tgttaagtgtaggagatttgaagaggcggtggaggttttccaaaggatgagggtggatagtaatgagaagattagtgaagctactgttgttagtagtttg |
35178372 |
T |
|
| Q |
214 |
actgcttgtgctgcgtcgaggaatgtggaagttgggaaggagattcatggttttataattgaaaaggaattggattttaccatgagaatggggaatgcgt |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35178373 |
actgcttgtgctgcgtcgaggaatgtggaagttgggaaggagattcatggttttataattgaaaaggaattggattttacaatgagaatggggaatgcgt |
35178472 |
T |
|
| Q |
314 |
tgttggatatgtattgtaagtgtggt |
339 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
35178473 |
tgttggatatgtattgtaagtgtggt |
35178498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 110
Target Start/End: Complemental strand, 2910174 - 2910113
Alignment:
| Q |
49 |
cggaaactgtttgatgaaatttctgagagagatagtgtttcgtggaatgttatgatttctgg |
110 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||| |||||||||||||| |||||| |||| |
|
|
| T |
2910174 |
cggaaactgtttaatgaaatgcctgagagagatttggtttcgtggaatgtgatgattactgg |
2910113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University