View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20909_low_19 (Length: 342)
Name: NF20909_low_19
Description: NF20909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20909_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 59 - 327
Target Start/End: Original strand, 38129404 - 38129665
Alignment:
| Q |
59 |
gggttccaagataggatatgtaatatatataatgtaattgtcaattatagtgaaatcatacacttgactctaatcgacgatgtcgaaactagcacaaaca |
158 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38129404 |
gggttctaagataggatatgtaatatatataatgtaattgtcaattatagtgaaatcatacacttgacactaatcgacgatgtcgaaactagcacaaaca |
38129503 |
T |
|
| Q |
159 |
taaaaagaaattggaaaaaatagcagggttccaatgtataatgtataattggcaattattgtgaaatcatacgctatacactaatcgacgatgtcgaagt |
258 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38129504 |
taaaaagaaattggaaaaaatagcagggttcc-------aatgtataattggcaattattgtgaaatcatacgctatacactaatcgacgatgtcgaagt |
38129596 |
T |
|
| Q |
259 |
tgtctccgacgctcgactgcacatcaggttccactgcgggaggagctggaggaatgggatgaatgatgt |
327 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38129597 |
tgtctccgaagctcgactgcacatcaggttccactgcgggaggagctggaggaatgggatgaatgatgt |
38129665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University