View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20909_low_24 (Length: 280)
Name: NF20909_low_24
Description: NF20909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20909_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 1 - 276
Target Start/End: Original strand, 14658602 - 14658875
Alignment:
| Q |
1 |
ccttctctttttgaggtcaacacacttctccaaccagtgttgttagaaacaaagggcacatattcgatgatcatagcactaagttacttctgacctaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
14658602 |
ccttctctttttgaggtcaacacatttctccaaccagtgttgttagaaacaaagggcacatattcgatgatcatagtactaagttacttttgacctaatt |
14658701 |
T |
 |
| Q |
101 |
gatattccttttagctaaaaaccattatgtatgtttataaatttgattttacatgatcttgattctacaaaattgatttcagtgtaaatacatttacgtt |
200 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| || |
|
|
| T |
14658702 |
gatattctttttagctaaaaatcattatgtatgcttataaatttgattttgcatgatcttgattctacaaaattgatttcagtataaatacatttacatt |
14658801 |
T |
 |
| Q |
201 |
gctgctggttactcttgggtcacatataattggagagtttcacataagaagttagacttataagcctatgattctt |
276 |
Q |
| |
|
| ||||||||||||||||||||| || |||||||||||||||||||||||| |||||| |||| ||| ||||||| |
|
|
| T |
14658802 |
gttgctggttactcttgggtcac--attattggagagtttcacataagaagtaagacttgtaagtctaggattctt |
14658875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University