View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20909_low_9 (Length: 437)
Name: NF20909_low_9
Description: NF20909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20909_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 77 - 421
Target Start/End: Original strand, 28922305 - 28922664
Alignment:
| Q |
77 |
cagtagttgcaattgcaacgtaatcacaattgaccatggtctcatcaaccttaatagacctcacagtatcaataatcacaattcgactgagatttaaaac |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
28922305 |
cagtagttgcaattgcaacgtaatcacaattgaccatggtctcatcaaccttaattgacctcacagtatcaatgatcacaattcgactgtgatttaaaac |
28922404 |
T |
|
| Q |
177 |
cttgcttaacatcaacagtccattgcctgtaaggtgggaactgcccccctcttataaactcattttcagggtgtaacccatccaatgcaagactcataac |
276 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||| |||| |
|
|
| T |
28922405 |
cttgcttaacatcaatagtccattgcctgtaaggtgggaactgcccccctcttataaactcattttcagggtttaacccatgcaatgcaagactcgtaac |
28922504 |
T |
|
| Q |
277 |
acacgctctcactagttgatggcccaatagactcatcttaacaaacgtctggagcatgacccaataaca---------------gaaggctcaataacag |
361 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |||||||| |
|
|
| T |
28922505 |
acacgctctcactagttgatggcccaatagactcatcttaacaaacgtctagagcatgacccaataacagaagacccaatacttgaaggctaaataacag |
28922604 |
T |
|
| Q |
362 |
aataccatcttaacagtttgtaaagtaaggattgtcccatgttataaactcatttaatcc |
421 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
28922605 |
aataccatcttaacagtttgtaaagtaaggattttcccatgttataaactcatttaatcc |
28922664 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University