View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2090_low_5 (Length: 267)
Name: NF2090_low_5
Description: NF2090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2090_low_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 13013818 - 13013685
Alignment:
| Q |
1 |
ccttgctgaaaccaattaggttctgtgtgttggccgaagatggatttgatttgtgctttgagagtttgggtggggcccaagttctttaggttgttctact |
100 |
Q |
| |
|
||||| |||||||||| |||||| ||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13013818 |
ccttgttgaaaccaataaggttcggtgtgttggttggagatggatttgatttgtgctttgagagtttgggtggggcccaagttctttaggttgttctact |
13013719 |
T |
 |
| Q |
101 |
aggtagggtgctcttagccctggtgtcttcttgt |
134 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
13013718 |
aggtagggtgctcttagccttggtgtcttcttgt |
13013685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 13084974 - 13084841
Alignment:
| Q |
1 |
ccttgctgaaaccaattaggttctgtgtgttggccgaagatggatttgatttgtgctttgagagtttgggtggggcccaagttctttaggttgttctact |
100 |
Q |
| |
|
||||| |||||||||| |||||| ||||||||| || |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13084974 |
ccttgttgaaaccaataaggttcggtgtgttggtcggagatggatttgatttgtgttttgagagtttgggtggggcccaagttctttaggttgttctact |
13084875 |
T |
 |
| Q |
101 |
aggtagggtgctcttagccctggtgtcttcttgt |
134 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
13084874 |
aggtagggtgctcttagccttggtgtcttcttgt |
13084841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University