View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2090_low_7 (Length: 224)
Name: NF2090_low_7
Description: NF2090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2090_low_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 20 - 212
Target Start/End: Complemental strand, 32988110 - 32987913
Alignment:
| Q |
20 |
tactagcatatcataacagtgagctaaccaaaagaagctaaagaatacgaggtgtagt-----tttaaggttacaaatttgccatcatgctaactaagaa |
114 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32988110 |
tactagcatatcataacagtgagccaaccaaaagaagctaaagaatacgaggtgtagtgtagttttaaggttacaaatttgccatcatgctaactaagaa |
32988011 |
T |
|
| Q |
115 |
aacaatccacgtggtcaacaaatctatgtctttttatcgactttccacagcttcattctccactgcttatgaacgtgctgaagtatatgttcttctct |
212 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32988010 |
aacaatccacatggtcaacaaatctatgtctttttatcgactttccacagcttcattctctactgcttatgaacgtgctgaagtatatgttcttctct |
32987913 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University