View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20911_low_13 (Length: 250)
Name: NF20911_low_13
Description: NF20911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20911_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 109 - 219
Target Start/End: Complemental strand, 34273541 - 34273431
Alignment:
| Q |
109 |
cattaagtgatataagttgatttattataaattcaacaactccatatgcattagggattacttaggtttttattacttgttgcgcttacttataacataa |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34273541 |
cattaagtgatataagttgatttattataaattcaacaactccatatgcattagggattacttaggtttttattacttgttgcgcttacttataacataa |
34273442 |
T |
|
| Q |
209 |
aatcatcaaca |
219 |
Q |
| |
|
||||||||||| |
|
|
| T |
34273441 |
aatcatcaaca |
34273431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 1 - 49
Target Start/End: Complemental strand, 34273648 - 34273600
Alignment:
| Q |
1 |
cctccgccaactcaaggccccaacttttccataatgagttaataaaaag |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34273648 |
cctccgccaactcaaggccccaacttttccataatgagttaataaaaag |
34273600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University