View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20912_high_5 (Length: 265)
Name: NF20912_high_5
Description: NF20912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20912_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 1 - 258
Target Start/End: Complemental strand, 23313753 - 23313496
Alignment:
| Q |
1 |
tattgtagtccacatatatgtcaccatcttcttggttttcaacagcgaagttagccagctccgatgcatgaacatcaagtgttagtttcttcagacactt |
100 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23313753 |
tattgtagtccacatatatgtcaacattttcttggttttcaacagcaaagttagccagctccgatgcatgaacatcaagtgttagtttcttcagacactt |
23313654 |
T |
 |
| Q |
101 |
atccaatgccatgttgcttggtttccaccatagtttgacactctcagttttactttccaactctttgtccaagtcttttgcataaccaggtgcctcaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23313653 |
atccaatgccatgttgcttggtttccactatagtttgacactctcaattttactttccaactctttgtccaagtcttttgcataaccaagtgcctcaaaa |
23313554 |
T |
 |
| Q |
201 |
taagaccacttttctggatccaatcccttaaatactccaacctcaccaccagaataat |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
23313553 |
taagaccacttttctggatccaatcccttaaatactccaacctcaacaccaaaataat |
23313496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 141
Target Start/End: Original strand, 33135699 - 33135839
Alignment:
| Q |
1 |
tattgtagtccacatatatgtcaccatcttcttggttttcaacagcgaagttagccagctccgatgcatgaacatcaagtgttagtttcttcagacactt |
100 |
Q |
| |
|
||||||||||||||||||||||| | ||||| | ||||||||||| || ||||||| || |||||||||||||||| |||| || || ||||||| |
|
|
| T |
33135699 |
tattgtagtccacatatatgtcaacttcttcaagattttcaacagcaaatttagccaattctaatgcatgaacatcaagacttagcttttttagacactc |
33135798 |
T |
 |
| Q |
101 |
atccaatgccatgttgcttggtttccaccatagtttgacac |
141 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33135799 |
atccaatggaatgttgcttggtttccaccatagtttgacac |
33135839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University