View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20913_low_5 (Length: 273)
Name: NF20913_low_5
Description: NF20913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20913_low_5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 15 - 262
Target Start/End: Complemental strand, 47971036 - 47970790
Alignment:
| Q |
15 |
tcaaacacaagtttgtagatattnnnnnnngaactcttaatttccaatcgtctactctttacattttcatgttgcaatatgtcgaagcatctctttcaaa |
114 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47971036 |
tcaaatacaagtttgtagatattaaaaaaagaactcttaatttccaatagtctactctttacattttcatgttgcaatatgtcgaagcatctctttcaaa |
47970937 |
T |
|
| Q |
115 |
gacgtataaccagatttgagtaatttagtaaggttttctaataaatnnnnnnnttactaaggttttaagcttttaaaatataatttaacttactatctta |
214 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
47970936 |
gacgtataatcagatttgagtaatttagtaaggttttctaataaa-aaaaaaattactcaggttttaagcttttaaaatagaatttaacttactatctta |
47970838 |
T |
|
| Q |
215 |
tatttagcctttaacttttatgaaacttggcatttaccagcacttcat |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47970837 |
tatttagcctttaacttttatgaaacttggcatttaccagcacttcat |
47970790 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University