View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20914_high_17 (Length: 335)
Name: NF20914_high_17
Description: NF20914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20914_high_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 60 - 319
Target Start/End: Original strand, 42960330 - 42960589
Alignment:
| Q |
60 |
ttctctttcatgtgaacaaggtttatctggaattgggtcattaagcacttcttgtgatctcaattctagtataatcttcgatggtgatgtttatattgaa |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42960330 |
ttctctttcatgtgaacaaggtttatctggaattgggtcattaagcacttcttgtgatctcaattctagtataatcttcgatggtgatgtttatattgaa |
42960429 |
T |
|
| Q |
160 |
ggaaatggaagtttaaatattcttcctggtgttaatttgacttgcccaatttcgggctgtgtgatcaaaatcaacatgagtgaagattttactttgcaaa |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42960430 |
ggaaatggaagtttaaatattcttcctggtgttaatttgacttgcccaatttcgggctgtgtgatcaaaatcaacatgagtgaagattttactttgcaaa |
42960529 |
T |
|
| Q |
260 |
atgattctgtgattattgctggtactgtttatgttgcagcaaaaaatgcaaacttgtttg |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42960530 |
atgattctgtgattattgctggtactgtttatgttgcagcaaaaaatgcaaacttgtttg |
42960589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University