View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20914_high_20 (Length: 299)
Name: NF20914_high_20
Description: NF20914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20914_high_20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 242
Target Start/End: Complemental strand, 3684124 - 3683883
Alignment:
| Q |
1 |
acaacaacgttaataaccttaacaacgttgttgttacttacaaagaatgtctcaaaaaccacgtggcaaccctaggtggtcatgccctagacggttgttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3684124 |
acaacaacgttaataaccttaacaacgttgttgttacttacaaagaatgtctcaaaaaccacgtggcaaccctaggtggtcatgccctagacggttgttg |
3684025 |
T |
|
| Q |
101 |
tgaattcatgccatcaccaaccgccacctccgatgaccctgcctccataaaatgtgccgcatgtggttgtcaccggaatttccaccgccgtgaaccggaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3684024 |
tgaattcatgccatcaccaaccgccacctccgatgaccctgcctccataaaatgtgccgcatgtggttgtcaccggaatttccaccgccgtgaaccggaa |
3683925 |
T |
|
| Q |
201 |
gaaccaatttccaccgtttttgaatatcaacctcatcaccgt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3683924 |
gaaccaatttccaccgtttttgaatatcaacctcatcaccgt |
3683883 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 39 - 202
Target Start/End: Complemental strand, 2494823 - 2494660
Alignment:
| Q |
39 |
tacaaagaatgtctcaaaaaccacgtggcaaccctaggtggtcatgccctagacggttgttgtgaattcatgccatcaccaaccgccacctccgatgacc |
138 |
Q |
| |
|
||||||||||||||||||||||| | |||| ||||||||||||||||||||| || ||| ||||||||||| |||||||||| || || | |||| |
|
|
| T |
2494823 |
tacaaagaatgtctcaaaaaccatgcagcaaacctaggtggtcatgccctagatggctgtggtgaattcatgacatcaccaacagcaacaccaaccgacc |
2494724 |
T |
|
| Q |
139 |
ctgcctccataaaatgtgccgcatgtggttgtcaccggaatttccaccgccgtgaaccggaaga |
202 |
Q |
| |
|
| | ||| |||||||||| || ||||| || ||||| || ||||||||||||||||| ||||| |
|
|
| T |
2494723 |
caacatccttaaaatgtgctgcttgtggctgccaccgtaacttccaccgccgtgaaccagaaga |
2494660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 30 - 193
Target Start/End: Original strand, 24181055 - 24181218
Alignment:
| Q |
30 |
gttgttacttacaaagaatgtctcaaaaaccacgtggcaaccctaggtggtcatgccctagacggttgttgtgaattcatgccatcaccaaccgccacct |
129 |
Q |
| |
|
|||||| |||||||||||||||||||||| || | ||| |||||||||| ||||| || || || ||| |||||||||||||| || || | || |
|
|
| T |
24181055 |
gttgtttcttacaaagaatgtctcaaaaatcatgctgcatccctaggtggacatgcacttgatggatgtggtgaattcatgccaccatcatctctcaatc |
24181154 |
T |
|
| Q |
130 |
ccgatgaccctgcctccataaaatgtgccgcatgtggttgtcaccggaatttccaccgccgtga |
193 |
Q |
| |
|
|| |||||||| ||| | |||||||| || ||||| |||||||||||||||||||||||||| |
|
|
| T |
24181155 |
ccaatgaccctagatccctcaaatgtgctgcttgtggctgtcaccggaatttccaccgccgtga |
24181218 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University