View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20914_high_21 (Length: 299)
Name: NF20914_high_21
Description: NF20914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20914_high_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 9 - 147
Target Start/End: Original strand, 37650405 - 37650543
Alignment:
| Q |
9 |
gtttctcacttcatcttctcgctattcctactgagcgcgaagtcttcagtggcgggaaactatatgtgggaccaacattcttcccgccaaaaatactttg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37650405 |
gtttctcacttcatcttctcgctattcctactgagcgcgaagtcttcagtggcgggaaactatatgtgggaccaacattcttcccgccaaaaatactttg |
37650504 |
T |
|
| Q |
109 |
tgggcttgttaacgggtatgggcctaatcatcgcggccc |
147 |
Q |
| |
|
||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
37650505 |
tggccttgttaacgggtatgggcctaaccatcgcggccc |
37650543 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 208 - 256
Target Start/End: Original strand, 37650604 - 37650652
Alignment:
| Q |
208 |
cagtattgaaaataaaataaaattatattcttcgtattttataatagga |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37650604 |
cagtattgaaaataaaataaaattatattctacgtattttataatagga |
37650652 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University