View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20914_high_29 (Length: 213)
Name: NF20914_high_29
Description: NF20914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20914_high_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 18 - 198
Target Start/End: Complemental strand, 8357716 - 8357536
Alignment:
| Q |
18 |
gattgtgtcacaacaacgacatgcttctaagctagcttcgaaatagtcaactagaagatgatgcaccttaaaattttgtgtcatgtttgttattatttct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8357716 |
gattgtgtcacaacaacgacatgcttctaagctagcttcgaaatagtcaactagaagatgatgcaccttaaaattttgtgtcatgtttgttattatttct |
8357617 |
T |
 |
| Q |
118 |
tgtcggggttcgagcaaatactcggtgagattaatgcatataggaggaagagatgttgaacaagaggtagagagtcctttg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
8357616 |
tgtcggggttcgagcaaatactcggtgagattaatgcatataggaggaagagatgttgaacaagaggtagagagtcttttg |
8357536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 18 - 169
Target Start/End: Original strand, 28593869 - 28594020
Alignment:
| Q |
18 |
gattgtgtcacaacaacgacatgcttctaagctagcttcgaaatagtcaactagaagatgatgcaccttaaaattttgtgtcatgtttgttattatttct |
117 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||||||| ||||||||||| |||||||||||| ||| || ||||||||||||| ||||| |
|
|
| T |
28593869 |
gattgtgtcacaacaacgacttgcttctaagctagcatcgaaatagttaactagaagatcatgcaccttaaagtttcgtctcatgtttgttatgatttca |
28593968 |
T |
 |
| Q |
118 |
tgtcggggttcgagcaaatactcggtgagattaatgcatataggaggaagag |
169 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| | ||||||||||||||||| |
|
|
| T |
28593969 |
tgtcggggttcgagcaaagactcggtgagattcaggcatataggaggaagag |
28594020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 18 - 89
Target Start/End: Complemental strand, 53447251 - 53447180
Alignment:
| Q |
18 |
gattgtgtcacaacaacgacatgcttctaagctagcttcgaaatagtcaactagaagatgatgcaccttaaa |
89 |
Q |
| |
|
|||| |||| |||||| || ||||||||||||| ||||| || ||||| ||||||||||||||||||||||| |
|
|
| T |
53447251 |
gattttgtcgcaacaaagatatgcttctaagctggcttcaaagtagtccactagaagatgatgcaccttaaa |
53447180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University