View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20914_high_30 (Length: 213)
Name: NF20914_high_30
Description: NF20914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20914_high_30 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 22 - 213
Target Start/End: Original strand, 30924651 - 30924841
Alignment:
| Q |
22 |
gtggtgtatgtgtttctccttagatcgtagg---gtgtggattctccccaagactaactgtgtatgtgtaacactgactctggcctcgttgaaatggtat |
118 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30924651 |
gtggtgtatgtgtttctccttagattgtaggtgggtgtggattctccccaa----aactgtgtatgtgtaacactgactctggccttgttgaaatggtat |
30924746 |
T |
 |
| Q |
119 |
ggaacagttgtggtatccaatgtccaagacattggctgagaaagctgcttgggatttttccaaagaaaatggtttggatgttgttgtggtgaatc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30924747 |
ggaacagttgtggtatccaatgtccaagacattggctgagaaagctgcttgggatttttccaaagaaaatggtttggatgttgttgtggtgaatc |
30924841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.00000007; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 129 - 190
Target Start/End: Complemental strand, 43557754 - 43557693
Alignment:
| Q |
129 |
tggtatccaatgtccaagacattggctgagaaagctgcttgggatttttccaaagaaaatgg |
190 |
Q |
| |
|
||||| |||||||| ||||||||||| || ||||| |||||||||| || |||||| ||||| |
|
|
| T |
43557754 |
tggtacccaatgtcaaagacattggcagaaaaagcagcttgggattattgcaaagagaatgg |
43557693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University