View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20914_low_14 (Length: 356)
Name: NF20914_low_14
Description: NF20914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20914_low_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 49; Significance: 6e-19; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 43 - 244
Target Start/End: Complemental strand, 34932463 - 34932262
Alignment:
| Q |
43 |
gttcgaaagcagacagccaagacaactgctgttcgaaagaagacagccaagagaactaaagttacaaggcagcagggaaagaaagcggcgaaggcttgaa |
142 |
Q |
| |
|
|||| |||| ||||||||||| |||||||| ||| ||||||||||| ||| | |||||||| ||||| ||||||||| || | || |||||| |
|
|
| T |
34932463 |
gttccaaaggagacagccaaggcaactgctcttcaaaagaagacaggcaaaaaggctaaagttccaagg-------gaaagaaagtggtggagacttgaa |
34932371 |
T |
|
| Q |
143 |
ttgaaaggacatccgaaatgtgaccactcagttgatgagtag-------acacgctctattctttcctttatctgttttagatgtcctgctgtttgataa |
235 |
Q |
| |
|
|| |||||| |||| ||||||| ||||| ||||||||||| |||| |||||||||||||||||||||||| |||||||| ||| ||||||| |
|
|
| T |
34932370 |
tttcaaggacgtccggaatgtgatcactctgttgatgagtattgtgtacacacactctattctttcctttatctgtttaagatgtcccactgcttgataa |
34932271 |
T |
|
| Q |
236 |
aagcaagac |
244 |
Q |
| |
|
||||||||| |
|
|
| T |
34932270 |
aagcaagac |
34932262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 34932475 - 34932418
Alignment:
| Q |
1 |
gctgatgctaaagttccaaaggagacagccaagacaattgctgttcgaaagcagacag |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||| ||| |||| |||||| |
|
|
| T |
34932475 |
gctgatgctaaagttccaaaggagacagccaaggcaactgctcttcaaaagaagacag |
34932418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University