View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20914_low_23 (Length: 297)
Name: NF20914_low_23
Description: NF20914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20914_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 103 - 293
Target Start/End: Complemental strand, 17835909 - 17835719
Alignment:
| Q |
103 |
ttaaaaccattgaaaattgaagtgaaattagaattcaaggatcaaatggatcaaattgaaaaagtttacaagagctatggagagaaaatgaggaaacttg |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
17835909 |
ttaaaaccattgaaaattgaagtgaaattagaattcaaggatcaaatggatcaaattgaaaaagtttacaagagctatgcagagaaaatgaggaaacttg |
17835810 |
T |
 |
| Q |
203 |
atatcttgaattaccaaaccatgcatgcattaggtgagaactaaatcatcttcatttcttagttaaattcttgcaattttaaacatttgaa |
293 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
17835809 |
atatcttgaattatcaaaccatgcatgcattaggtgagaactaaatcatcttcatttcttatttaaattcttgcaattttaaacatttgaa |
17835719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University