View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20914_low_25 (Length: 275)
Name: NF20914_low_25
Description: NF20914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20914_low_25 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 139 - 275
Target Start/End: Complemental strand, 54086267 - 54086131
Alignment:
| Q |
139 |
cccaatttaatcaacgatccatattccaacaacaacgatgatgaagatgaacgcaaacaaaagaaacaaaaactcttaattggtttgaattctcatctcc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54086267 |
cccaatttaatcaacgatccatattccaacaacaacgatgatgaagatgaacgcaaacaaaagaaacaaaaactcttaattggtttgaattctcatctcc |
54086168 |
T |
 |
| Q |
239 |
aaaacccaactacattattctccaattctcaaactcc |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54086167 |
aaaacccaactacattattctccaattctcaaactcc |
54086131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 63 - 102
Target Start/End: Complemental strand, 54086343 - 54086304
Alignment:
| Q |
63 |
aaagaggaagaagaagggtcgtccatctctgttggatctt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54086343 |
aaagaggaagaagaagggtcgtccatctctgttggatctt |
54086304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University