View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20914_low_28 (Length: 246)
Name: NF20914_low_28
Description: NF20914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20914_low_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 18 - 125
Target Start/End: Original strand, 27380995 - 27381102
Alignment:
| Q |
18 |
gttgtttagattttgatttccagtgaaagcggcgaaagggacgcatataaagaaaaaacaattgttgttggaagtcttggaggttgagaagccattaata |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27380995 |
gttgtttagattttgatttccagtgaaagcggcgaaagggacgcatataaagaaaaaacaattgttgttggaagtcttggaggttgagaagccattaata |
27381094 |
T |
 |
| Q |
118 |
atgtgtgt |
125 |
Q |
| |
|
||||||| |
|
|
| T |
27381095 |
gtgtgtgt |
27381102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 83; Significance: 2e-39; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 150 - 232
Target Start/End: Original strand, 54086072 - 54086154
Alignment:
| Q |
150 |
caatggagaaacggaaactcacgttttgatctgatccggggtgattagggtgaaattggggagtttgagaattggagaataat |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54086072 |
caatggagaaacggaaactcacgttttgatctgatccggggtgattagggtgaaattggggagtttgagaattggagaataat |
54086154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University