View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20914_low_29 (Length: 232)
Name: NF20914_low_29
Description: NF20914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20914_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 20 - 221
Target Start/End: Complemental strand, 37745637 - 37745436
Alignment:
| Q |
20 |
gtgcaaaaccttaacccatcaggaccatagtttacacctgcagcaaagttaccagggctactgggaagtatcccatttcctcctcccatattgaaagttt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37745637 |
gtgcaaaaccttaacccatcaggaccatagtttacacctgcagcaaagttaccagggctactgggaagtatcccatttcctcctcccatattgaaagttt |
37745538 |
T |
 |
| Q |
120 |
caggatgtttcacactctccttcagtaaccttccagctccttccacatgaattgaacaaaatataaccaacacaatgcacaacatcaccacctttgctac |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
37745537 |
caggatgtttcacactctccttcagtaaccttccagctccttccacatgatttgaacaaaatataaccaacacaatgcacaacatcaccacctttgcaac |
37745438 |
T |
 |
| Q |
220 |
tc |
221 |
Q |
| |
|
|| |
|
|
| T |
37745437 |
tc |
37745436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University